2025 NSTA Philadelphia • EDVOTEK® Workshops

EDVOTEK Workshops offered at the 2025 NSTA National Conference in Philadelphia. Thursday & Friday March 27 & 28. 1. Left at the Scene of the Crime:High School Forensics 2. Sweet Science: Exploring Complex Mixtures with Biotechnology 3. Introducing Your Students to Gene Editing with CRISPR 4. Transform Your Class into a Neuroscience Laboratory 5. Teaching the Polymerase Chain Reaction in One Lab Period 6. Exploring the Genetics of Taste: SNP Analysis of the PTC Gene Using PCR 7. Exploring STEAM With Transformation

EDVOTEK® WORKSHOPS • 2025 NSTA PHILADELPHIA

TABLE OF CONTENTS

WORKSHOP

PAGE

01 Forensic Escape Room: Design Your Own Biotech Adventure 02 Introducing Your Students to CRISPR with Sickle Cell Gene Editing

15 27

03 Lion Family Reunion: Conservation Biology Genetics

04 Put the M into STEM: Quantitative Techniques for Biotechnology 39 05 DNA Detective: Reuniting Families with DNA Fingerprinting & Electrophoresis 51 06 Color Your Classroom: Engaging Students with Bacteria & Bio-Art 67 07 Trailblazers: Investigating Chemotaxis with C. elegans 79

Check Out Our 2025 Interactive Resource Guide!

CLICK

Visit our website at www.edvotek.com

Forensic Escape Room: Design Your Own Biotech Adventure

Introduction Explore the world of forensic science with these fun and exciting escape room activities! Try forensic blood detection and agarose gel electrophoresis experiments, decipher clues, and solve puzzles. Learn to design your own escape room to have students unravel the evidence and free the innocent. Background Information Excerpts from EDVO-Kit 190 Crime scene analysts play a crucial role in collecting and preserving evidence, as contamination can compromise investigations. They identify materials such as blood, trace substances, and even skin cells under a victim’s nails to aid forensic analysis. Forensic scientists use various techniques to examine evidence, including presumptive tests , which indicate the presence of a substance, and confirmatory tests , which verify its identity. Microscopic and molecular analyses then compare evidence with potential suspects. Advancements in genetics have transformed forensic science, allowing DNA analysis from even tiny biological samples. Techniques like PCR and DNA fingerprinting help solve crimes and bring criminals to justice. FORENSIC SAMPLE ANALYSIS FOR BLOOD Blood is often found at crime scenes, in spatters, drops, and drips. Analyzing these spatters is a field of study in itself! Most blood spatter evidence is found around the victim or where the violence occurred. Blood itself can be found on clothes, skin, or in the get-away vehicle. However, a red stain on the floor at a crime scene can’t be immediately assumed to be human blood, nor can it be assumed to belong to the perpetrator. When something that is suspected to be blood is found at a crime scene, detectives will work quickly to secure the evidence and send it to a forensic lab for testing. Forensic scientists exercise caution before performing long, expensive DNA fingerprinting test on a sample that is not human blood. So, the first step when dealing with potential blood evidence is to confirm its human origin. This process begins with a simple presumptive test to distinguishes between blood and non-blood. Then, blood group typing is performed to confirm the sample is human and to help narrow down the suspects based on their blood group. The Kastle-Meyer test, introduced in 1903, is the most used presumptive test for detecting blood. It uses phenolphthalin and hydrogen peroxide to identify the presence of blood in samples. Phe- nolphthalin is a reduced form of the acid-base indicator phenolphthalein (Box 1). Phenolphthalein changes from clear to pink in basic solutions. When phenolphthalein in a basic solution gains two electrons, it shifts from pink to clear. This reduced molecule is used for the Kastle-Meyer test. To perform the test, the potential blood sample is collected on a cotton-tipped swab and then treated with a few drops of 95% ethanol to lyse, or break open, the cellular membranes. Next, phenolphthalin solution is applied, followed promptly by hydrogen peroxide. This sequence trig- gers a reaction where the iron in hemoglobin reacts with hydrogen peroxide, generating water BOX 1: Chemistry of the Kastle-Meyer Test The phenolphthalein (C 2 0H 16 O 4 ) used in the Kastle-Meyer test has been reduced, i.e. it has gained electrons, and is actually called phenolphthalin (C 2 0H 14 O 4 ) . The reaction in the Kastle-Meyer test is based on the reac- tion between the iron in hemoglobin and hydrogen peroxide (H 2 O 2 ). The iron in hemoglobin reduces (sup- plies electrons to) the H 2 O 2 , creating water (H 2 O). This reaction depletes the hemoglobin of electrons, which are in turn supplied by phenolphthalin. The oxidation, i.e. the release of electrons, of phenolphthalin turns it back into phenolphthalein, which has a characteristic pink color. Fe 4+ + C 2 0H 14 O 4 + H 2 O 2 → C 2 0H 16 O 4 + H 2 O + Fe 3+

Visit our website at www.edvotek.com

Forensic Escape Room: Design Your Own Biotech Adventure

and free oxygen molecules. The hemoglobin loses electrons during this process, which are then donated back to hemoglobin by the phenolphthalein molecule. This causes the indicator to change from clear to pink, indicating blood. The Kastle-Meyer test is valued for its speed, specificity for hemoglobin, and reliability, even with dilute samples. However, it may yield false positive results due to chemicals like iron and copper

oxides that can react with the hy- drogen peroxide. While it remains an efficient presumptive test, its susceptibility to false positives necessitates caution. The next step in blood testing is to confirm the identity of the sample using a test that definitively detects blood. One such confirmatory test is ABO blood group testing, which categorizes blood into types A, B,

Antigen on Red Blood Cells

Antibody in Blood

Percentage of Population

Blood Type

A B AB O

A B A & B O

anti-B anti-A none anti-A & anti-B

42% 10% 4% 44%

Figure 1: Types of Blood in the Population

AB, and O based on the presence or absence of A and B antigens on the surface of red blood cells. Testing for blood groups relies on the precipitation of an antigen-antibody complex, called agglutination, using specific antibodies that bind to the surface proteins. Blood samples are mixed with antibodies to either the A or B antigens, and the samples are allowed to incubate. If either the antibody or the blood cells are in excess, there is no visible reaction. However, when both components are present at a similar concentration, the interactions between the antigens and the antibodies form large complexes that precipitate out of solution in a state known as equivalence. The mixture in the wells will look granular instead of smooth, which is easy to detect by eye. Only blood will produce this agglutination, which is why it is classified as a confirmatory blood test. Although confirmatory tests like blood typing are more time-consuming and costly than presump - tive tests, they offer superior accuracy. While it cannot pinpoint a specific perpetrator, blood typing can help narrow down suspects by identifying groups of individuals with matching blood types or by eliminating those with incompatible blood types, aiding in criminal investigations. The next step would be DNA fingerprinting, to identify the origin of the blood sample more conclusively. DNA FINGERPRINTING Once a sample has been confirmed to be human blood or tissue, the DNA is extracted and analyzed using DNA Fingerprinting. In humans, DNA is packaged into 23 pairs of chromosomes that are inherited from an individual’s biological parents. Although most of this genetic material is identical in every person, small differences, or “polymorphisms”, in the DNA sequence occur throughout the genome. For example, the simplest difference is a Single Nucleotide Polymorphism (or SNP). Changes in the number and location of restriction enzyme sites result in Restriction Frag- ment Length Polymorphisms (or RFLPs). Short repetitive stretches of DNA at specific locations in the genome can vary in number to produce STRs (Short Tandem Repeats) and VNTRs (Variable Number of Tandem Repeats). Although most polymorphisms occur in non-coding regions of DNA, those that disrupt a gene can result in disease. Analyzing several different polymorphisms within a person’s genome generates a unique DNA “fingerprint” that can allow us to distinguish one individual from another, or even to determine familial relationships. The best-known application of DNA fingerprinting is in forensic science. DNA fingerprinting tech - niques are utilized to interpret blood, tissue, or fluid evidence collected at accidents and crime scenes. After DNA is extracted from these samples, forensic scientists can develop a DNA finger - print. Following collection, the DNA is extracted from the cells, amplified using the Polymerase Chain Reaction (or PCR, box 2), and fragmented into smaller pieces using specific restriction enzymes. These fragments are analyzed using agarose gel electrophoresis, a technique which uses a porous

1.800.EDVOTEK • www.edvotek.com • info@edvotek.com

Forensic Escape Room: Design Your Own Biotech Adventure

gel matrix and an electrical current to separate DNA fragments by size. After electrophoresis is completed, the gel is stained, and the banding patterns examined. Each band is like a puzzle piece that, when analyzed, reveals similarities and discrepancies between the crime scene and suspect samples. A match provides strong evidence that the suspect was present at the crime scene. This methodical process serves as a cornerstone in criminal investigations, offering a scientific means to establish connections and resolve cases with accuracy and precision. Data from crime scene evidence can suggest that a suspect was at a crime scene, but that data alone cannot convict a person of a crime. Many lines of evidence, including witness statements and alibis, must come together to build a case against a suspect. These results are used as evi- Monica Homewood has been arrested as the main suspect in the murder of her husband, Bryce Homewood. She has been questioned multiple times and continues to plead innocent to the crime. Monica’s lawyer is trying to prove her innocence and has convinced the Charleston Police Department to further investigate the crime scene. You are the best forensic analyst that money can buy in Charleston. Your job is to determine if the evidence collected at the crime scene contains blood, what blood type the blood evidence is, and to use DNA fingerprinting to determine who committed the crime. Will your forensics skill help prove Monica’s innocence? The following information and evidence are required for your forensic assessment of the crime. dence in the court of law. ESCAPE ROOM SCENARIO

Visit our website at www.edvotek.com

Forensic Escape Room: Design Your Own Biotech Adventure

OFFICIAL POLICE REPORT

RESPONDING OFFICER: Caitlin Marlow

DETAILS OF EVENT: On Saturday night, police dispatch received a distressed phone call from a woman in her mid-30’s, claiming to have returned home to find her husband dead in their kitchen. Dispatch sent Caitlin Mar - low, the local police sheriff, to the crime scene in a small suburban condo in Charleston, South Caro - lina. Upon arriving at the condo, Sheriff Marlow found a deceased man with a traumatic head injury, including a deep laceration, in the kitchen. Marlow and her crime scene investigators collected the evidence from the scene to be analyzed by the crime scene team. Upon initial inspection of the scene, the following primary evidence was collect- ed: glass shards (from a broken iced tea pitcher) with what appears to be blood splatter on the kitchen table (Sample 1), a knife near the table with apparent blood on it (Sample 2), potential blood spatter on the hardwood floor near the kitchen table (Sample 3), and a tall glass with women’s lipstick on it. Later, the coroner was able to identify the body as Bryce Homewood. The cause of death was de - termined as a traumatic head injury. Glass shards in the head wound matched the broken glass from the iced tea pitcher found at the crime scene. A mysterious note with unintelligible text was found in the victim’s pocket. Marlow and her team of detectives questioned the neighbors in the condo complex. They deter- mined Monica Homewood, Deena Granville, and Alex Johnson to be the three main suspects of this crime. According to eyewitness reports, both Monica and Deena were seen at the scene of the crime one (1) hour before the call to the police dispatch. Neighbors also noted that a local real estate agent, Alex Johnson, was seen talking with Mr. Homewood at the condo the night before. THE VICTIM: • Bryce Homewood , aged 32, was a graphic designer for an advertising agency. He was married to Monica Homewood. He was known for his sharp wit and humor, though sometimes he veered into the realm of abuse and/or harassment when angry. SUSPECTS: • Monica Homewood , 33, works as a pediatric nurse at a local children’s hospital. She was the distressed woman from the police dispatch phone call. She is also married to the victim. Most of the neighbors complained about their constant arguments. Their fights often disrupted the peaceful condo building. When questioned about her whereabouts during the crime, Monica claimed to have gone to an urgent care to take care of a deep wound she claims she obtained accidentally while cooking dinner with Bryce. It was confirmed by the local urgent care that Monica was treated for a knife wound. • Deena Granville , 34, is the neighbor and HOA president. She works as a marketing manager for a fashion retail company. She is known for being a stickler on the HOA rules and ever since the Home- woods moved in, there have only been fights between Bryce and Deena. Neighbors also noted that Bryce was also constantly fighting with Deena over excessive property management fees. The meeting notes from the HOA meetings prove that the two have a history of be- ing verbally aggressive towards each other. • Alex Johnson , 38 - Real Estate Agent. Alex Johnson has ongoing disputes with Bryce over a contest- ed condo sale. At the time of the crime, he claimed to be attending a local real estate conference which investigators have yet to confirm. Neighbors noted Alex had a strained relationship with the victim due to their frequent clashes over business deals, but he always maintained a professional demeanor in their interactions. SAMPLES PENDING FORENSIC ANALYSIS: Potential blood evidence found at the crime scene. Tests to be performed include Kastle-Meyer testing, Blood Group Typing and DNA Fingerprinting.

1.800.EDVOTEK • www.edvotek.com • info@edvotek.com

Forensic Escape Room: Design Your Own Biotech Adventure

Module I: Kastle-Maeyer Test

The first steps of your forensic analysis will use the Kastle-Meyer test as a presumptive test for blood. You will test the three crime scene samples to see if they are positive or negative for the presence of blood.

25 µL evidence

50 µL Phenolphthalin solution

50 µL Hydrogen peroxide solution

50 µL ethanol

1. Use a transfer pipet to ADD 1 drop (or 25 µL) of blood evidence to the swab. NOTE: Using more than one drop (25 µL) of evidence may affect the results.

2. Use a transfer pipet to ADD 2 drops (or 50 µL) of 95% ethanol to the swab. NOTE any color change. PLACE the pipet and remaining ethanol to the side for testing additional samples. 3. Use a new pipet to ADD 2 drops (or 50 µL) of the phenolphthalin solution to the swab. NOTE any color change. No color change is expected even if blood is present. PLACE the pipet and remaining phenolphthalin to the side for testing additional samples.

IMPORTANT For steps 2-4: When adding the detection reagents, hold the evidence swab at a steep angle, with the crime scene sample at the bottom.

4. Use a new pipet to ADD 2 drops (or 50 µL) of hydrogen peroxide solution “H2O2” to the swab. NOTE any color change. A pink color is expected after several seconds if blood is present. RECORD your results in the chart below.

REPEAT steps 1-4 for each blood evidence sample.

Crime Scene Sample #

Positive or Negative for Blood

CS1

CS2

CS3

Visit our website at www.edvotek.com

Forensic Escape Room: Design Your Own Biotech Adventure

Module II: Blood Type Test

Now that some samples from the crime scene have been identified as blood using the Kastle-Meyer test, it is necessary to confirm the blood type of the samples. In this module, you will perform ABO testing on the blood samples from the crime scene. This will allow us to determine which crime scene blood samples are from the victim, and which samples were from the suspects. NOTE: Bryce is blood type O, Deena is blood type B, Alex is blood type A, and Monica is blood type B.

1. PLACE a microtiter plate piece as shown below. Using a permanent marker, label the plate. The column labels will include the four control blood types (A, B, AB, O) and any Module I crime scene samples that test positive for blood. The row labels will be Anti-A and Anti-B.

A B AB O

Anti A

Anti B

2. ADD 50 μL or two drops of each control blood type sample into each of the two corre - sponding wells. For example, control blood type A goes into the two wells under the letter “A”. Repeat the same procedure for the control blood types B, AB, O, and the two positive blood samples from the crime scene. Each well requires 50 μL. 3. Use a new pipette tip to ADD 50 μL or 2 drops of Anti-A serum into each of the wells in row #1. The same tip or transfer pipet can be used for all samples in row #1. 4. Use a new pipette tip to ADD 50 μL or 2 drops of Anti-B serum into each of the wells in row #2. The same tip or transfer pipet can be used for all samples in row #2. 5. Firmly HOLD the plate piece on the lab bench as shown. Very gently TAP the side of the plate with your finger near the positive crime scene samples to MIX for approximately 20- 30 seconds. Do this VERY CAREFULLY to avoid spilling any of the samples from the wells. PROCEED to the next step. 6. To visualize the results, PLACE the microtiter plate on a white light transilluminator, or use a bright flashlight held above the plate. COMPARE the crime scene evidence with the control blood samples. RECORD your results.

1.800.EDVOTEK • www.edvotek.com • info@edvotek.com

Forensic Escape Room: Design Your Own Biotech Adventure

Module III: DNA Fingerprinting After using blood typing to determine which samples are from the suspect, you must use DNA fingerprinting to find out who the blood came from. You send the suspects’ blood samples as well as the blood collected from the knife to an external DNA lab. Here they will extract DNA from each sample and amplify it by PCR. In this module, you will use gel electrophoresis to analyze the PCR samples obtained from the suspects and compare them to the blood found at the scene.

1:00

Concentrated buffer

Distilled water

Agarose

60°C

Flask

Caution! Flask will be HOT!

WAIT

POUR

60°C

ADD diluted SYBR Safe

60°C

CASTING THE AGAROSE GEL 1. DILUTE concentrated (50X) buffer with distilled water to create 1X buf - fer (see Table A).

REMINDER: This kit requires 0.8% agarose gels cast with at least 4 wells.

2. MIX agarose powder with 1X buffer in a 250 mL flask (see Table A). 3. DISSOLVE agarose powder by boiling the solution. MICROWAVE the solution on high for 1 minute. Carefully REMOVE the flask from the microwave and MIX by swirling the flask. Continue to HEAT the solu- tion in 15-second bursts until the agarose is completely dissolved (the solution should be clear like water). 4. COOL agarose to 60 °C with careful swirling to promote even dissipation of heat. 5. While agarose is cooling, SEAL the ends of the gel-casting tray with the rubber end caps. PLACE the well template (comb) in the appropriate notch. 6. Before casting the gel, ADD diluted SYBR® Safe to the molten agarose and swirl to mix (see Table A). 7. POUR the cooled agarose solution into the prepared gel-casting tray. The gel should thor- oughly solidify within 20 minutes. The gel will stiffen and become less transparent as it solidifies. 8. REMOVE end caps and comb. Take particular care when removing the comb to prevent damage to the wells. Individual 0.8% UltraSpec-Agarose™ with SYBR ® Stain

7 x 7 cm

0.6 mL

29.4 mL

0.24 g

30 mL

30 µL

10 x 7 cm*

0.9 mL

44.1 mL

0.36 g

45 mL

45 µL

14 x 7 cm

1.2 mL

58.8 mL

0.48 g

60 mL

60 µL

* Recommended gel volume for the EDGE™ Integrated Electrophoresis System.

Visit our website at www.edvotek.com

Forensic Escape Room: Design Your Own Biotech Adventure

Module III: DNA Fingerprinting, continued

RUNNING THE GEL 9.

REMINDER: Before loading the samples, make sure the gel is properly oriented in the

PLACE gel (on the tray) into electrophoresis chamber. COVER the gel with 1X electrophoresis buffer (See Table B for recommended vol - umes). The gel should be completely submerged. 10. PUNCTURE the foil overlay of the QuickStrip™ with a pipet tip. LOAD the entire sample (35 µL) into the well as indicated by the Gel Loading table.

apparatus chamber.

11. PLACE safety cover. CHECK that the gel is properly oriented. Remem- ber, the DNA samples will migrate toward the positive (red) electrode. 12. CONNECT leads to the power source and PERFORM electrophoresis. (See Table C for time and voltage guidelines.) 13. After electrophoresis is complete, REMOVE the gel and casting tray from the electropho- resis chamber.

VISUALIZING the SYBR® GEL SLIDE gel off the casting tray onto the viewing surface of the transilluminator. TURN the unit on. DNA should appear as bright green bands on a dark background. PHOTOGRAPH results.

GEL LOADING TABLE

SAMPLE A B C D

LANE 1 2 3 4

SAMPLE NAME DNA standard marker Crime scene sample Deena PCR Reaction Monica PCR Reaction

Time and Voltage Guidelines (0.8% Agarose Gel)

1x Electrophoresis Buffer (Chamber Buffer)

EDGE™

M12 & M36

Volts

Min/Max (minutes)

EDGE™

150 mL

3 mL

147 mL

150 125 100

10/20

20/35 30/45 40/60

M12

400 mL

8 mL

392 mL

N/A

M36

1000 mL

20 mL

980 mL

15/25

1.800.EDVOTEK • www.edvotek.com • info@edvotek.com

Forensic Escape Room: Design Your Own Biotech Adventure

Experimental Results and Analysis

MODULE I ANALYSIS

Negative Sample

Positive Sample

CS1 was negative and did not produce any color change after adding H 2 O 2 , while CS2 and CS3 turned bright pink and were posi- tive. Therefore, CS2 and CS3 should continue on for confirmatory testing.

MODULE II ANALYSIS

The crime scene sample CS2 is type O and crime scene sample CS3 is type B blood. Both Deena and Monica are type B. While blood typing can narrow down suspects, DNA testing would have to be

performed to conclusively say if the blood belongs to either of the two suspects. Therefore, PCR samples from crime scene sample CS3 should be DNA tested alongside PCR samples from Monica and Deena.

MODULE III ANALYSIS

The DNA standards in Lane 1 make it possible to measure the DNA bands obtained from the PCR reactions. The results of this analysis indicates an identical pattern in Lanes 2 and 4. This is strong evidence that the crime scene DNA matches the sample from Monica. In criminal investigations, several known variable regions in DNA are analyzed to match crime scene and suspect DNAs.

TUBE A B C D

LANE 1 2 3 4

SAMPLE NAME DNA standard marker Crime scene sample Deena PCR Reaction Monica PCR Reaction

MOLECULAR WEIGHTS 6751, 3652, 2827, 1568, 1118, 825, 630 3000, 1282 3000 3000, 1282

Visit our website at www.edvotek.com

Forensic Escape Room: Design Your Own Biotech Adventure

Related Products

EDGE™ Integrated Electrophoresis System Runs one 10 x 7 cm gel Cat# 500

M12 Complete™ Electrophoresis Package For 1 or 2 Lab Groups Cat# 502-504

DuoSource™ 100/150 V, for 1 or 2 Units Cat# 509

QuadraSource™ 10-300 V, for 1 or 4 Units Cat# 5010

White Light LED Transilluminator Cat# 552

EDVOTEK® Variable Micropipette 5-50 µL Micropipette Cat. # 590

TruBlu™ Jr Blue Light Transilluminator Cat# 555

Long Wave UV Light Cat# 969

Fixed Volume MiniPipette™ 35 µL MiniPipette™ Cat. # 587-2

Details for all these products and MORE can be found on our website!

Visit our website at www.edvotek.com

Introducing Your Students to CRISPR with Sickle Cell Gene Editing

1.800.EDVOTEK • www.edvotek.com • info@edvotek.com

Introducing Your Students to CRISPR with Sickle Cell Gene Editing

Background Information The gene editing tool CRISPR-Cas9 was developed by bacteria at the beginning of evolutionary history as a defense against viral attacks. It was created by nature, not human beings, but we discovered it in the late 1980s. We figured out how it worked in the early years of this century, and have now made it into a valuable part of our efforts to improve human health, make our food supply hardier and more resistant to disease, and advance any arm of science that involves living cells, such as biofuels and waste management. The CRISPR-Cas System in Action

In 1987 Yoshizumi Ishino and colleagues at Osaka University in Japan were researching a new microbial gene when they discovered an area within it that contained five identical segments of DNA made up of the same 29 base pairs. The segments were separated

Figure 1: Bacterial CRISPR Region.

from each other by 32-base pair blocks of DNA called spacers, and each spacer had a unique configuration (Figure 1). This section of DNA didn’t resemble anything microbiologists had seen before and its biological significance was unknown. Eventually these strange segments and spac - ers would be known as Clustered Regularly Interspaced Short Palindromic Repeats – or CRISPR. Scientists also discovered that a group of genes coding for enzymes they called Cas (CRISPR- associated enzymes) were always next to CRISPR sequences. In 2005, three labs noticed that the spacer sequences resembled viral DNA and everything fell into place. When a virus invades a bacterium, the bacterium identifies the virus as foreign and collects some of its DNA so it can be recognized the next time it shows up. The bacterium puts the viral DNA into a spacer in the CRISPR section of its own DNA. As the spacers fill up with viral DNA, they become a database of viral enemies. To set up an ongoing defense system, the bacterium takes each piece of viral DNA out of storage in the spacers and transcribes it into a strand of RNA, then a Cas enzyme binds to one of these loaded RNA strands. Together, the viral-loaded RNA and the Cas enzyme drift through the cell. If they encounter foreign DNA that matches the spacer sequence, the RNA will base-pair so the Cas enzyme can chop the invader’s DNA into pieces and prevent it from replicating. This system made other bacterial defenses, such as restriction enzymes, look very primitive. When they used CRISPR-Cas, bacteria could find any short sequence of DNA and attack it with precision. CRISPR-Cas9 History Because DNA sequencing technology was in its infancy in 1987, the Japanese scientists didn’t know if the mysterious structure they had discovered only occurred in E. coli ; but by the late 1990s technology had advanced and microbiologists could sequence most of the microbial DNA in seawater and soil samples.

Thanks in part to the newly available DNA sequencing data, a study led by Ruud Hansen found that the Cas enzymes could snip DNA but didn’t know why. At the same time, Alex - ander Bolotin’s team at the French National Institute for Agricultural Research found that the spacers all share a common sequence they called the protospacer adjacent motif (PAM). The PAM enables Cas enzymes to recognize their target. Different Cas enzymes recognize different PAM sequences; the most

Figure 2: Target DNA and PAM site.

Visit our website at www.edvotek.com

Introducing Your Students to CRISPR with Sickle Cell Gene Editing

commonly-used Cas9 from Streptococcus pyogenes recognizes the PAM sequence 5’-NGG-3’, where “N” can be any nucleotide base (Figure 2). The discovery that CRISPR spacers were related to viral DNA sequences occurred by three different groups of scientists. Eu - gene Koonin, an evolutionary biologist at the National Center for Biotechnology Information in Bethesda, Maryland, developed a theory that bacteria were using CRISPR to fight off viruses. Koo -

If you’ve eaten yogurt or cheese, chances are you’ve eaten CRISPR-ized cells. – Rodolphe Barrangou

nin’s theory was tested by Roldolphe Barrangou and Philippe Horvath, then microbiologists at the yogurt company Danisco in France. The company used bacteria to convert milk into yogurt, and entire cultures could be wiped out by bacteria-killing viruses. Barrangou and his team in- fected one of their yogurt bacteria – Streptococcus thermophilus – with two strains of viruses and

cultured the resistant bacteria that survived the assault. Upon examination, they found DNA from the viruses they had used inside CRISPR spacers. Some of the other contributors to CRISPR-Cas be- tween 2002 and 2013 include: John van der Oost of the University of Wageningen in The Netherlands (the discovery of small CRISPR RNAs), Luciano Marraffini and Erik Sontheimer at Northwestern University in the USA (CRISPR targets DNA, not RNA), Sylvain Moineau at the University of Laval in Canada (CRISPR-Cas9 can produce double-strand- ed breaks in target DNA), and Virginijus Siksnys at Vilnius University in Lithuania (CRISPR systems are self-contained units that can be cloned, and Cas9 can be reprogrammed to a site of choice by chang- ing the sequence of the CRISPR rRNA). The next step in the CRISPR story was carried out by three different scientists at almost the same time: Jennifer Doudna at the University of Califor- nia in Berkeley who worked on microbial CRISPR- Cas systems; Emmanuelle Charpentier, then at the University of Vienna in Austria, who also worked on microbial CRISPR-Cas systems; and Feng Zhang at the Broad Institute of MIT who pioneered CRISPR systems in mammalian and human cells. All three of these scientists created mechanisms that made CRISPR a real research tool and not just an interesting phenomenon.

Cas9

gRNA

Binding to target

Double-stranded cut

Figure 3: CRISPR targeting and digestion of DNA.

Jennifer Doudna was an RNA expert who was trying to discover all the things that RNA can do besides being a protein tem- plate. She had already found that it could be used as a sensor and could control the activity of genes when Blake Wiedenheft joined her laboratory. Wiedenheft wanted to study Cas en- zymes to understand how they worked, and Doudna sponsored his research because she thought the chemistry would be interesting, not because she thought CRISPR had any practical applications.

You’re not trying to get to a particular goal except understanding. – Jennifer Doudna

What they discovered was that Cas enzymes could cut DNA and were programmable. Using the CRISPR-Cas9 system from Streptococcus pyogenes , which causes strep throat, Doudna and her colleagues figured out how to hand the Cas9 enzyme an RNA molecule that matched a sequence of DNA they wanted to cut from the genome, then guide it to the target site (Figure 3). Meanwhile, Charpentier and her colleagues were mapping all the RNAs in Streptococcus pyogenes and finding a large number of new small RNA molecules they called trans-activating CRISPR RNA (tracrRNA) that lived close to the S. pyogenes CRISPR system. They also discovered that, unlike other CRISPR systems that contained one RNA strand and many proteins, S. pyogenes ’ CRISPR

1.800.EDVOTEK • www.edvotek.com • info@edvotek.com

Introducing Your Students to CRISPR with Sickle Cell Gene Editing

system contained two RNAs (tracrRNA and CRISPR RNA) and only one protein – Cas9. This system was so much simpler than other CRISPR systems that the team thought it could be har- nessed as a powerful genetic engineering tool. Charpentier predicted that the two RNAs worked together to guide Cas9 to specific viral DNA sequences, and she was right. Charpentier presented her findings in 2010 at a CRISPR meeting in Wageningen, The Nether - lands, and it was the highlight of the conference. In 2011, she and Doudna met at an American Society for Microbiology meeting in Puerto Rico and agreed to collaborate on the problem of how Cas9 cleaved DNA and how it could be adapted to make targeted cuts in a genome. They solved this problem and their results have been used successfully around the world. At the same time, Feng Zhang, an MIT researcher exploring the genetics of complex psychiat- ric and neurological diseases, was looking at ways to edit eukaryotic human and mammalian cells. In 2010, he published a report on how to do so using a previously developed gene editing system called TALEN. He published a second paper in 2012 outlining how he and his team had used CRISPR-Cas9 to edit the genome of mammalian cells, and in 2015 announced the creation of a simpler and more precise tool called CRISPR-Cpf1. In 2016, CRISPR-CasC2c2, that targets RNA rather than DNA, was unveiled. Putting CRISPR-Cas to Work The ability of CRISPR-Cas to specifically target and cut DNA, combined with modern DNA sequencing, has opened new avenues in genetic engineering, molecular biology, and synthetic biology. Researchers can determine the sequence of a segment of a gene, design a CRISPR guide RNA (gRNA) to specifically cut the DNA, and combine everything within a cell to efficiently change the DNA. The gRNA combines the tracrRNA and CRISPR RNA into a single DNA molecule, simplifying delivery into a cell. One of the most common uses of CRISPR technology is to digest a gene to disrupt its function. Once cut, DNA repair mechanisms will try to mend the double stranded break, often resulting in small insertions, deletions, or other mutations that disrupt gene function. In addition to using CRISPR-Cas systems to disrupt mutated genes, scientists can use CRISPR to replace them with genes Figure 4 - Repairing DNA Using HDR

that function the way they are supposed to (Figure 4). First, the DNA is cut using CRISPR-Cas to create a double stranded break. Next, the cells are given a template DNA strand, containing the correct sequence, which can be incorporated into the cut DNA using homology directed repair (HDR). With HDR, the natural cel- lular machinery will incorporate the template DNA into the ge- nome at the site of the CRISPR di- gest. By controlling the template DNA strand, researchers can repair mutated genes or even insert entirely new genes into an organism. CRISPR-Cas systems allow researchers to easily place the new genes precisely where they want them, unlike some of the older methods of gene therapy where the new genes are randomly inserted into the plant or animal genomes. Scientists are already using CRISPR to insert new genes into healthy genomes that will make plants, in particular, more 4

CRISPR-Cas targeting DNA

Corrected DNA sequence

Homologous DNA sequences

Homology Directed Repair (HDR)

Repaired DNA

Figure 4: Repairing DNA Using HDR

Visit our website at www.edvotek.com

Introducing Your Students to CRISPR with Sickle Cell Gene Editing

resistant to disease, able to better withstand the weather where they grow, or produce higher crop yields. Some past projects include increasing the vitamin A content of yams in developing countries to combat eye disease and inserting human genes for the blood components used to treat hemophilia into tobacco plants. Are There Any Risks When Using CRISPR-Cas in a Living Organism? Nature’s creations aren’t formed in a laboratory, they are formed in specific environments for specific purposes and sometimes parts of that original environment are critical to their success. The sickle cell trait is a good example. Sickle cell anemia is an inherited disease caused by a mutation that produces an abnormal hemoglobin protein. The mutated hemoglobin can change the shape of red blood cells, causing them to become rigid and get caught in blood vessels. The sickle cell trait originally developed in Africa as a defense against malaria. The twisted blood cells are resistant to infection from malaria, and cyanate, a chemical found in the local guava and cas- sava plants, can help to minimize some of the difficulties from the mutated cells. When African people went to parts of the world that did not contain cyanate-rich plants, those oddly shaped red blood cells began to cause additional problems. Similarly, although initial research has been extremely successful, scientists have discovered a number of unexpected results while using CRISPR-Cas in eukaryotic organisms. For example, although CRISPR-Cas cleavage is incredibly specific, it is still possible to have off-target effects - sites in the DNA with matching sequences to the guide RNA, as well as unexpected sites that are still targeted and digested. In addition, some studies have linked CRISPR to a potential increase in cancer risk in early non-clinical tests. Therefore, additional experimentation is essential to ensure safety before each round of clinical trials. The CRISPR mechanism developed in single-celled organisms (bacteria) to fight off other single- celled organisms (viruses). It is possible that our attempts to use this system outside of bacteria is leading to some of these unexpected issues. Scientists are trying to use it in complex, multicel- lular organisms with thousands of internal wild-card variables and many more environmental variables that come into play. Basic genetics tells us that, while there are approximately 3 billion base pairs in human DNA, only about 2% of them are organized into genes that can be translated into the messenger RNA (mRNA) that tells our cells how to make proteins. The other 98% of our genome is made up of what we call non-coding DNA, and we have very limited ideas about what that does. So far we have discovered that non-coding DNA plays a role in how genes are expressed, the architecture of the chromosomes, and how we inherit specific traits as a species, but how it does these things is still unclear and there are undoubtedly other functions performed by that mysterious 98% about which we know nothing at all. When we start tinkering with the genome, we can expect surprises, and not all of them will be pleasant ones. But the only way to find out what we need to know is to begin exploring. It will take years to understand how our genome works and how each part of it affects the others, so we must pro - ceed rigorously and cautiously, a small step at a time. Fortunately, a small step at a time with no object but exploring an interesting phenomenon is a classical description of good science.

Scientists in many countries are now performing hundreds of CRISPR experiments with the diverse goals of repairing defective DNA in mice, editing genes in crops to engineer a better food supply, and rewriting the genome of the elephant to recreate a woolly mammoth. New companies using Doudna, Charpentier, and Zhang’s technologies are starting up to address everything from new cancer treatments to altering insect genomes and eliminating the mosquitoes that carry malaria. Using CRISPR as a Therapeutic for Hemoglobinopathies In this experiment, you will investigate the use of CRISPR as a therapeutic treatment for genetic diseases that affect hemoglobin, known as hemoglobinopathies. Hemoglobin, a crucial molecule in the body, is a heterotetramer composed

Figure 5: Structure of haemoglobin 1

1.800.EDVOTEK • www.edvotek.com • info@edvotek.com

Introducing Your Students to CRISPR with Sickle Cell Gene Editing

of four different subunits (Figure 5) . Within adult hemoglobin, there are two types of subunits: Alpha hemoglobin (HbA, depicted in red) and Beta hemoglobin (HbB, depicted in blue). Each subunit contains an iron-containing heme group responsible for oxygen binding and transport. In healthy red blood cells (RBCs), hemoglobin exists as tetramers, facilitating its vital role in oxygen transport throughout the body. A third hemoglobin subunit, fetal hemoglobin or HbF, is expressed in utero and in newborn babies (Figure 6). Fetal hemoglobin ceases production around the age of two, giving way to the increased synthesis of HbB. Diseases like beta-thalassemia and Sickle Cell affect the HbB subunit of hemoglobin. Beta- thalassemia is a disorder where the body does not produce enough of the HbB subunit, leading to lower concentrations of hemoglobin and reduced oxygen in the body. In Sickle Cell disease, amino acid substitutions compromise the HbB subunit, changing the shape of the red blood cell and causing clumping in small blood vessels. Depending on the alleles, the symptoms can vary in severity. Common symptoms include fatigue, anemia, pain and swelling, and shortness of breath. Through medical and clinical research on hemoglobinopathies, scientists observed that individuals who continue to produce HbF past infancy experience milder symptoms. This is be- cause HbF can compensate for HbB in the hemoglobin complex. Expression of HbF is controlled by BCL11A protein, which turns off production of HbF in young children. New genetic therapies like Casgevy use CRISPR to inactivate the BCL11A gene, turning on production of fetal hemo- globin. Data from the clinical trial shows that the gene therapy was effective in the majority of patients, signaling an improvement in their quality of life. First, you will design guide RNAs (gRNA) that recruit Cas9 to target the BCL11A gene, resulting in a double stranded break. Next, DNA samples will be analyzed from five CRISPR experiments. In each sample, DNA from the BCL11A gene has been amplified and combined with Cas9 and a unique gRNA. If the Cas9:gRNA complex is successfully able to cleave the BCL11A gene, it will reveal multiple bands during agarose gel electrophoresis. This will allow you to select the gRNAS that can potentially be used to inactivate the BCL11A gene. After successful gene editing, the HbF gene will turn on, expressing the fetal hemoglobin subunit and alleviating the symptoms of beta-thalassemia or sickle cell anemia.

Figure 6: Gene expression of hemoglobin before and after birth. 2

Image Attributions: 1 Zephyris at the English-language Wikipedia, CC BY-SA 3.0 <http://creativecommons.org/licenses/by-sa/3.0/>, via Wikimedia Commons 2 Postnatal_genetics.svg: original: Furfur, File:Haemoglobin-Ketten.svg, derivation/translation:Leonid 2 deriva- tive work: Leonid 2, CC BY-SA 3.0, via Wikimedia Commons

Visit our website at www.edvotek.com

Introducing Your Students to CRISPR with Sickle Cell Gene Editing

Module I: Designing gRNA to Target BCL11A

In this module, you will design guide RNA (gRNA) using DNA sequence of the BCL11A gene, ef- fectively inactivating the gene and turning on production of HbF. To design the gRNA, you will first identify PAM sites in the target sequence. For this experiment, assume that you are using a Cas9 enzyme from Streptococcus pyogenes, which uses an “NGG” PAM site. In this notation, the “N” can be any nucleotide. This means that the Cas9 will only bind to sequences immediately upstream ( in the 5’ direction ) of an AGG, TGG, CGG, or GGG sequence. Since Cas9 can bind to either of the complementary DNA strands it is necessary to examine both for PAM sequences. In the example gRNA below, the PAM sequence is "AGG", located on the antisense strand of the sequence. Therefore, the target sequence is the 20 nt in the 5' direction of the PAM site. 1. Record the complementary nucleotides to the CFTR sequence below. Some of the comple- mentary sequence has already been filled in for you (labeled as "Example gRNA") . 2. Identify five PAM sites for Streptococcus pyogenes Cas9. Circle or highlight the sites within the DNA sequence. Note: Remember that this Cas9 recognizes “NGG” as a PAM sequence.

5’ 3’

Example gRNA

3’ 5’

3. Identify the 20 nucleotides immediately upstream (in the 5’ direction) of each PAM site. This is the target sequence. Record the sequence in the Table, below.

PAM Sequence

Sample Name

Target Sequence (spacer)

Example gRNA #1 gRNA #2 gRNA #3 gRNA #4 gRNA #5

CTTTTTCTGTTAAAACATCT

AGG

1.800.EDVOTEK • www.edvotek.com • info@edvotek.com

Introducing Your Students to CRISPR with Sickle Cell Gene Editing

Module II: Agarose Gel Electrophoresis

Concentrated buffer

Distilled water

Agarose

60°C

Flask

Caution! Flask will be HOT!

WAIT

POUR

60°C

CASTING THE AGAROSE GEL

1. DILUTE concentrated 50X Electrophoresis buffer with distilled water (refer to Table A for correct volumes depending on the size of your gel casting tray). 2. MIX agarose powder with buffer solution in a 250 mL flask (refer to Table A). 3. DISSOLVE agarose powder by boiling the solution. MICROWAVE the solution on high for 1 minute. Carefully REMOVE the flask from the microwave and MIX by swirling the flask. Continue to HEAT the solution in 15-second bursts until the agarose is com- pletely dissolved (the solution should be clear like water). 4. COOL agarose to 60 °C with careful swirling to promote even dissipation of heat. 5. While agarose is cooling, SEAL the ends of the gel-casting tray with the rubber end caps. PLACE the well template (comb) in the appropriate notch. 6. POUR the cooled agarose solution into the prepared gel-casting tray. The gel should thoroughly solidify within 20 minutes. The gel will stiffen and become less transpar - ent as it solidifies. 7. REMOVE end caps and comb. Take particular care when removing the comb to pre- vent damage to the wells.

Individual 0.8% UltraSpec-Agarose™ Gels

7 x 7 cm

0.6 mL

29.4 mL

0.24 g

30 mL

10 x 7 cm*

0.9 mL

44.1 mL

0.36 g

45 mL

* Recommended gel volume for the EDGE™ Integrated Electrophoresis System. 60 mL *Recommended gel volume for the EDGE™ Integrated Electrophoresis System. (Cat. #500). 14 x 7 cm 1.2 mL 58.8 mL 0.48 g

Visit our website at www.edvotek.com

Introducing Your Students to CRISPR with Sickle Cell Gene Editing

Module II: Agarose Gel Electrophoresis, continued

RUNNING THE GEL

8. PLACE the gel (still on the tray*) into the electrophoresis chamber. COVER the gel with 1X Electrophoresis Buffer (See Table B for recommended volumes). The gel should be completely submerged.

9. PUNCTURE the foil overlay of the QuickStrip™ with a pipet tip. LOAD the entire sample (35 µL) into the well in the order indicated by Table 1, at right. 10. PLACE safety cover on the unit. CHECK that the gel is properly ori- ented. Remember, the DNA samples will migrate toward the posi- tive (red) electrode. 11. CONNECT leads to the power source and

REMINDER: Before loading the samples, make sure the gel is properly oriented in the apparatus chamber.

Tube A Tube B Tube C Tube D Tube E Tube F TABLE 1: GEL LOADING

PERFORM electrophoresis (See Table C for time and voltage guidelines). Allow the tracking dye to migrate at least 3 cm from the wells. 12. After electrophoresis is complete, REMOVE the gel and casting tray from the electro- phoresis chamber and PROCEED to gel staining.

Lane 1 2 3 4 5 6

DNA Standard Marker gRNA #1 gRNA #2 gRNA #3 gRNA #4 gRNA #5

Time and Voltage Guidelines (0.8% Agarose Gel)

1x Electrophoresis Buffer (Chamber Buffer)

EDGE™

M12 & M36

Volts

Min/Max (minutes)

EDGE™

150 mL

3 mL

147 mL

150 125 100

10/20

20/35 30/45 40/60

M12

400 mL

8 mL

392 mL

N/A

M36

1000 mL

20 mL

980 mL

15/25

1.800.EDVOTEK • www.edvotek.com • info@edvotek.com

Page 1 Page 2 Page 3 Page 4 Page 5 Page 6 Page 7 Page 8 Page 9 Page 10 Page 11 Page 12 Page 13 Page 14 Page 15 Page 16 Page 17 Page 18 Page 19 Page 20 Page 21 Page 22 Page 23 Page 24 Page 25 Page 26 Page 27 Page 28 Page 29 Page 30 Page 31 Page 32 Page 33 Page 34 Page 35 Page 36 Page 37 Page 38 Page 39 Page 40 Page 41 Page 42 Page 43 Page 44 Page 45 Page 46 Page 47 Page 48 Page 49 Page 50 Page 51 Page 52 Page 53 Page 54 Page 55 Page 56 Page 57 Page 58 Page 59 Page 60 Page 61 Page 62 Page 63 Page 64 Page 65 Page 66 Page 67 Page 68 Page 69 Page 70 Page 71 Page 72 Page 73 Page 74 Page 75 Page 76 Page 77 Page 78 Page 79 Page 80 Page 81 Page 82 Page 83 Page 84 Page 85 Page 86 Page 87 Page 88 Page 89 Page 90

www.edvotek.com

Made with FlippingBook flipbook maker