06 - Introducing Your Students to CRISPR with Sickle Cell Gene Editing
Module I: Designing gRNA to Target BCL11A In this module, you will design guide RNA (gRNA) using DNA sequence of the BCL11A gene, ef- fectively inactivating the gene and turning on production of HbF. To design the gRNA, you will first identify PAM sites in the target sequence. For this experiment, assume that you are using a Cas9 enzyme from Streptococcus pyogenes, which uses an “NGG” PAM site. In this notation, the “N” can be any nucleotide. This means that the Cas9 will only bind to sequences immediately upstream ( in the 5’ direction ) of an AGG, TGG, CGG, or GGG sequence. Since Cas9 can bind to either of the complementary DNA strands it is necessary to examine both for PAM sequences. In the example gRNA below, the PAM sequence is "AGG", located on the antisense strand of the sequence. Therefore, the target sequence is the 20 nt in the 5' direction of the PAM site. 1. Record the complementary nucleotides to the CFTR sequence below. Some of the comple- mentary sequence has already been filled in for you (labeled as "Example gRNA") . 2. Identify five PAM sites for Streptococcus pyogenes Cas9. Circle or highlight the sites within the DNA sequence. Note: Remember that this Cas9 recognizes “NGG” as a PAM sequence.
5’ 3’
Example gRNA
3’ 5’
3. Identify the 20 nucleotides immediately upstream (in the 5’ direction) of each PAM site. This is the target sequence. Record the sequence in the Table, below.
PAM Sequence
Sample Name
Target Sequence (spacer)
Example gRNA #1 gRNA #2 gRNA #3 gRNA #4 gRNA #5
CTTTTTCTGTTAAAACATCT
AGG
71
1.800.EDVOTEK • www.edvotek.com • info@edvotek.com
Made with FlippingBook flipbook maker